B2-SINE-RNA

ENA TPA Accession :
Print
Download


Entry NameAlias
B2 SINE RNA None known
Characteristics
Short interspersed element (SINE) repeat present in more than 10^5 copies in the mouse genome ((Kramerov 1979))

Repeat is ~180nuc long ((Krayev 1982)) but expressed B2 RNAs vary from ~0.2-0.6kb ((Kramerov 1982),(Fornace 1986)).

The 5' of B2 SINE is derived from a tRNA ((Lawrence 1985), (Daniels 1985)) while the 3' contains an A rich sequence ((Krayev 1982)).

Transcribed by RNA polymerase III ((Krayev 1982), (Singh 1985)).
Expression
Expression highly induced upon viral infection ((Singh 1985)), heat shock ((Fornace 1986)) and differentially regulated during development ((Bachvarova 1988)).

Also shows higher expression in some tumour cells ((Kramerov 1982)).

Found in the nucleus ((Espinoza 2004)) and the cytoplasm ((Kramerov 1982)).
Function
B2 SINE RNA is a specific inhibitor of RNA polymerase II ((Allen 2004)).

During heat shock B2 RNA associated with RNA polymerase II and repressed its action. Nb: Only saw association of B2 RNA with RNA polymerase II after heat shock. ((Allen 2004)).

Represses transcription by stably binding an RNA docking site on the core polymerase II complex and blocking activity of the RNA polymerase preinitiation complex ((Espinoza 2004)). To achieve this B2 RNA disrupts polymerase DNA binding at the promoter, preventing the formation of an active closed complex around the DNA ((Yakovchuk 2009)).

51 nucleotide sequence from 3' half is sufficient for binding to and repressing RNA polymerase II ((Espinoza 2007)).
Conservation
Rodents: mouse, rat, chinese hamster ((Krayev 1982))
Misc
Known that upon heat shock RNA polymerase II is transiently repressed.

In humans Alu repeat RNAs appear to play the role B2 RNA does in rodents upon heat shock. Alu and B2 elements have different origins but show convergent evolution functionally.

B2 sequence provided is 177nt sequence specified by Espinoza et al. 2004 as mouse B2 RNA gene (region 121488-121665 of Mus musculus chromosome 18, clone RP23-6p18, GenBank accession number AC020972).
Species
Species UCSC Genome Browser Link
Rattus norvegicus (Rat) N/A
Mus musculus (Mouse) mm9 chr18:37,205,741-37,205,917
Cricetulus griseus (Chinese hamster) N/A
Literature
Pub Med ID Author Title Year
15300240 Allen The SINE-encoded mouse B2 RNA represses mRNA transcription in response to heat shock. 2004
15300239 Espinoza B2 RNA binds directly to RNA polymerase II to repress transcript synthesis. 2004
17307818 Espinoza Characterization of the structure, function, and mechanism of B2 RNA, an ncRNA repressor of RNA polymerase II transcription. 2007
370792 Kramerov Long double-stranded sequences (dsRNA-B) of nuclear pre-mRNA consist of a few highly abundant classes of sequences: evidence from DNA cloning experiments. 1979
6296779 Krayev Ubiquitous transposon-like repeats B1 and B2 of the mouse genome: B2 sequencing. 1982
2426659 Fornace Induction of B2 RNA polymerase III transcription by heat shock: enrichment for heat shock induced sequences in rodent cells by hybridization subtraction. 1986
6130513 Kramerov The sequences homologous to major interspersed repeats B1 and B2 of mouse genome are present in mRNA and small cytoplasmic poly(A) + RNA. 1982
3839306 Lawrence Analysis of repetitive sequence elements containing tRNA-like sequences. 1985
2581137 Singh Expression of enhanced levels of small RNA polymerase III transcripts encoded by the B2 repeats in simian virus 40-transformed mouse cells. 1985
3851163 Daniels Repeat sequence families derived from mammalian tRNA genes. 1985
19307572 Yakovchuk B2 RNA and Alu RNA repress transcription by disrupting contacts between RNA polymerase II and promoter DNA within assembled complexes. 2009
2461884 Bachvarova Small B2 RNAs in mouse oocytes, embryos, and somatic tissues. 1988

showing of total 13 results

Associated Components
Component Type Component ID Description Pub Med ID
Protein RNA polymerase II B2 binds RNA polymerase II core protein complex and inhibits transcription 15300239
Sequences
Sequence Name Sequence Accession IDs Species Fasta Sequence
b2-sine-rna_mm_1 Mus musculus ggctggtgagatggctcagtgggtaagagcacccgactgctcttccgaaggtcaggagttcaaatcccagcaaccacatggtggctcacaaccatccgtaacgagatctgattccctcttctggagtgtctgaagacagctacagtgtacttacatataataaataaataaatcttt





lncrnadb version 2.0. lastupdate : 03 Sep 2015